View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_6 (Length: 690)
Name: NF1242_low_6
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_6 |
 | |
|
| [»] scaffold0170 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0170 (Bit Score: 161; Significance: 2e-85; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 107 - 279
Target Start/End: Original strand, 19727 - 19899
Alignment:
| Q |
107 |
cgcaaatatcatgaaaattctttcagatctagttgcggttgcatcttgtcttctttttcttgaatcatatttggaagcttgtgtagatctttgaaccttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19727 |
cgcaaatatcatgaaaattctttcagatctagttgcggttgcagcttgtcttctttttcttgaatcatatttggaagcttgtgtagatctttgaaccttg |
19826 |
T |
|
| Q |
207 |
agcagacttaatgcaaatgttacatttacttttgtttcttgaaatgttgggaattatagaaaataagtttgtt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19827 |
agcagacttaatgcaaatgttacatttacttttgttccttgaaatgttggcaattatagaaaataagtttgtt |
19899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 7e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 130 - 242
Target Start/End: Complemental strand, 3001706 - 3001600
Alignment:
| Q |
130 |
cagatctagttgcggttgcatcttgtcttctttttcttgaatcatatttggaagcttgtgtagatctttgaaccttgagcagacttaatgcaaatgttac |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||| || ||||||| ||||||||||| ||||||||||||||| || ||||||||| || |
|
|
| T |
3001706 |
cagatctagttgcggttgcagcttgtcttctt------gaatcaaatatggaagcatgtgtagatctatgaaccttgagcagatttgatgcaaatgctat |
3001613 |
T |
|
| Q |
230 |
atttacttttgtt |
242 |
Q |
| |
|
| ||| ||||||| |
|
|
| T |
3001612 |
agttatttttgtt |
3001600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University