View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_8 (Length: 627)
Name: NF1242_low_8
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 387 - 618
Target Start/End: Original strand, 35725869 - 35726100
Alignment:
| Q |
387 |
tgtcttcaattagctttgtttctattttagtgatgccaacaactttcaaaaaatcacatacatattctatgtactatttgtctctcatgatctctttgcc |
486 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
35725869 |
tgtcttcaattacctttgtttctattttagtgatgccaacaactttccaaaaatcacatacatattatatgtactatttgtctcccatgatctctttgcc |
35725968 |
T |
|
| Q |
487 |
gaatgtaaagtttcattcttcctaacaatttaagaaaaatatgtagtagagttcatgattatttgtgtttatagcattgtctttgaatgagagtgaaaaa |
586 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35725969 |
gattgtaaagtttcattcttcctaacaatttaagaaaaatatgtagtagagttcgtgattatttgtgtttatagcattgtctttgagtgagagtgaaaaa |
35726068 |
T |
|
| Q |
587 |
ataagaaagtttttaaagatgattagtataat |
618 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |
|
|
| T |
35726069 |
ataagagagtttttaaagatgattagtataat |
35726100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University