View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_80 (Length: 303)
Name: NF1242_low_80
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_80 |
 |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 5e-56; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 92 - 206
Target Start/End: Complemental strand, 14530139 - 14530025
Alignment:
| Q |
92 |
attctgcatatcttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14530139 |
attctgcatatcttatctatgattgtttttatttgccatttcaaacctctttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtct |
14530040 |
T |
 |
| Q |
192 |
caaaaatgtcaaagc |
206 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14530039 |
caaaaatgtcaaagc |
14530025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 92 - 206
Target Start/End: Complemental strand, 14534488 - 14534374
Alignment:
| Q |
92 |
attctgcatatcttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtct |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14534488 |
attctgcatatcttatctatgattgtttttatttgccatttcaaacctttttacggtcttttttcaggccatgggtggtaattgaaaaacaagtgggtct |
14534389 |
T |
 |
| Q |
192 |
caaaaatgtcaaagc |
206 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
14534388 |
caaaaatgtcaaagc |
14534374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 136 - 198
Target Start/End: Complemental strand, 14516994 - 14516932
Alignment:
| Q |
136 |
acctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaat |
198 |
Q |
| |
|
|||| ||||| ||||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14516994 |
acctctttactgtcttttatcaggccatgggtggtaattgaaaaacaagtaggtctcaaaaat |
14516932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 87 - 206
Target Start/End: Original strand, 37339973 - 37340092
Alignment:
| Q |
87 |
agattattctgcatatcttatctatgattgtttttatttgccatttcaaacctttttaccgtctttt-ttcaggccatgggtggtaattgaaaaacaagt |
185 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||||| ||||||||||| |||||| || || ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37339973 |
agataattctgtatatgttatctatgattgttttcatttgccattt-aaacctcttcactgtctttttttcaggccatgggtggtaattgaaaaacaagt |
37340071 |
T |
 |
| Q |
186 |
gggtctcaaaaatgtcaaagc |
206 |
Q |
| |
|
|| ||||||||| ||||||| |
|
|
| T |
37340072 |
aggcctcaaaaatatcaaagc |
37340092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 103 - 206
Target Start/End: Original strand, 37328762 - 37328864
Alignment:
| Q |
103 |
cttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaacaagtgggtctcaaaaatgtca |
202 |
Q |
| |
|
||||| ||| |||||| | |||||||||| |||||| || || || ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |
|
|
| T |
37328762 |
cttatgtattattgttatcatttgccattg-aaacctcttcactgtattttttcaggccatgggtgataattgaaaaacaagtgggtctcaaaaatatca |
37328860 |
T |
 |
| Q |
203 |
aagc |
206 |
Q |
| |
|
|||| |
|
|
| T |
37328861 |
aagc |
37328864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 104 - 182
Target Start/End: Original strand, 23347142 - 23347220
Alignment:
| Q |
104 |
ttatctatgattgtttttatttgccatttcaaacctttttaccgtcttttttcaggccatgggtggtaattgaaaaaca |
182 |
Q |
| |
|
|||||||||||||| || |||| ||||| |||||| ||||| |||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
23347142 |
ttatctatgattgtattgattttgcatttgaaacctctttactgtctcttttcaagccatgggtgttaattgaaaaaca |
23347220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 182
Target Start/End: Complemental strand, 163504 - 163472
Alignment:
| Q |
150 |
ttttttcaggccatgggtggtaattgaaaaaca |
182 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
163504 |
ttttttcaagccatgggtggtaattgaaaaaca |
163472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University