View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_87 (Length: 297)
Name: NF1242_low_87
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_87 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 85 - 276
Target Start/End: Complemental strand, 52153216 - 52153025
Alignment:
| Q |
85 |
atactaatttggcattcaactatttgggtcgcggtttttgagtgtttaaggaaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttct |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153216 |
atactaatttggcattcaactatttgggtcgcggtttttgagtgtttaagggaggctggtgttgggttggcaggttggtgtgtttctgcaggggtgttct |
52153117 |
T |
|
| Q |
185 |
ttcaagctgctgcctggtgtagtttggagttatcaatgccttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52153116 |
ttcaagctgctgcctggtgtagtttggagttatcaatgccttgtttttatgccgtagagagtctggcgtgggttctgtagttggccgattct |
52153025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University