View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_88 (Length: 293)
Name: NF1242_low_88
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_88 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 71 - 280
Target Start/End: Original strand, 16847792 - 16848000
Alignment:
| Q |
71 |
acttacctcatttacactattcatttatagatgtacgatagttcagacatgtccttgcaatatttttgttgttttaatatgtttcagtttttctcaaatg |
170 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16847792 |
acttacctcatttacactatgcatttatagatgtacgatagttcagacatgtccttgcaatatttttgttgttttaatatgtttcagtttttctcaaatg |
16847891 |
T |
 |
| Q |
171 |
aactaggcagcaattgagggtttcctgatctgaaagagtagatgttaatccatgagttagccagtttgcatatactgtgatgatatgtacttgaatgaat |
270 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16847892 |
aactaagcagcaattgaggg-ttcctgatctgaaagagtagatgttaatgcatgagttagccagtttgcatatactgtgatgatatgtacttgaatgaat |
16847990 |
T |
 |
| Q |
271 |
tgtccagtat |
280 |
Q |
| |
|
|||||||||| |
|
|
| T |
16847991 |
tgtccagtat |
16848000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University