View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_90 (Length: 291)
Name: NF1242_low_90
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_90 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 51 - 225
Target Start/End: Original strand, 36941638 - 36941812
Alignment:
| Q |
51 |
taattcttgttttacttgaaactacattcccactagaagaagtgcttccaagagaagttgataaacttcctgctgaaattgttggagacaacttctcatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36941638 |
taattcttgttttacttgaaactacattcccactagaagaagtgcttccaagagaagttgataaacttcctgctgaaattgttggagacaacttctcatg |
36941737 |
T |
|
| Q |
151 |
ctgagaagagaaattcagttgctcgactgataaatgataagatccacgagcaacctgcaaacggatgctataatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36941738 |
ctgagaagagaaattcagttgctcgactgataaatgataagatccacgagcaacctgcaaacggatgctataatt |
36941812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University