View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_94 (Length: 287)
Name: NF1242_low_94
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_94 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 47 - 266
Target Start/End: Complemental strand, 30903877 - 30903658
Alignment:
| Q |
47 |
cattagtaacataggattatcatcaactattggattgagaaattatcaaattctaacgcactaatcatcctagaccaatacgcaaaacaacgatgagtaa |
146 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30903877 |
cattagcaacataggattatcatcaactattggattgagaaattatcaaattctaacgcactaatcatcctagaccaatacgcaaaacaacgatgagtaa |
30903778 |
T |
 |
| Q |
147 |
aagtatgatgtactattatctagtcacttaagtaactcatcagttaccactagtagnnnnnnnnngcttggtacaatgttgttggtactaattgtttact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
30903777 |
aagtatgatgtactattatctagtcacttaagtaactcatcagttaccactagtagtttctttttgcttggtacaatgttgttggtattaattgtttact |
30903678 |
T |
 |
| Q |
247 |
acagtagaaactagagagta |
266 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30903677 |
acagtagaaactagagagta |
30903658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University