View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1242_low_96 (Length: 286)
Name: NF1242_low_96
Description: NF1242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1242_low_96 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 47 - 265
Target Start/End: Complemental strand, 30903877 - 30903658
Alignment:
| Q |
47 |
cattagtaacataggattatcatcaactattggattgagaaattatcaaattctaacgcactaatcatcctagaccaatacgcaaaacaacgatgagtaa |
146 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30903877 |
cattagcaacataggattatcatcaactattggattgagaaattatcaaattctaacgcactaatcatcctagaccaatacgcaaaacaacgatgagtaa |
30903778 |
T |
|
| Q |
147 |
aagtatgatgtactattatctagtcacttaagtaactcatcagttaccactagtag-nnnnnnnngcttggtacaatgttgttggtactaattgtttact |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
30903777 |
aagtatgatgtactattatctagtcacttaagtaactcatcagttaccactagtagtttctttttgcttggtacaatgttgttggtattaattgtttact |
30903678 |
T |
|
| Q |
246 |
acagtagaaactagagagta |
265 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30903677 |
acagtagaaactagagagta |
30903658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University