View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12430_high_13 (Length: 306)
Name: NF12430_high_13
Description: NF12430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12430_high_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 9 - 306
Target Start/End: Original strand, 35743900 - 35744194
Alignment:
| Q |
9 |
agcataggtggcggaggcggtggtggtggaggtgccgagggtggtaatatctgtacnnnnnnnggcattatcgtgaatggtgcaggtaggggaggagggg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||| |
|
|
| T |
35743900 |
agcataggtggcggaggcggtggtggtggaggtgccgagggtggtaatatctgtactttttttggcatcat---gaatggtgcaggtaggggaggagggg |
35743996 |
T |
 |
| Q |
109 |
gtgggggagaagatgaagaaatagacattgatgcttgttgcagatgagaaggtgtttgtgttggtttaggagaatttggttgaaatcgtttaggagatag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35743997 |
gtgggggagaagatgaagaaatagacattgatgcttgttgtagatgagaaggtgtttgtgttggtttaggagaatttggttgaaattgtttaggagatag |
35744096 |
T |
 |
| Q |
209 |
tggtaactccacttcttccataacttgatcatgtttaaccattttttgatgatgatcatcctcatttgtgtccaaatcacagacaagatcctctgatg |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35744097 |
tggtaactccacttcttccataacttgatcatgtttaaccattttttgatgatgatcatcctcatttgtgtccaaatcacagacaagatcctctgatg |
35744194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University