View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12430_high_4 (Length: 352)
Name: NF12430_high_4
Description: NF12430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12430_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 157 - 341
Target Start/End: Complemental strand, 38707021 - 38706837
Alignment:
| Q |
157 |
acaagcttgatagttccgtcttcattagaataatactggtagatagatcatggtttaggggttgatctctttgtggtctcagcggctgttggtccttact |
256 |
Q |
| |
|
||||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38707021 |
acaagcttgatagctccattttcattagaataatactggtagatagatcatggtttaggg-ttgatctctttgtggtctcagcggctgttggtccttact |
38706923 |
T |
|
| Q |
257 |
gataggagggaattgttgtggattatttgggttctcttagggtgggctaaggttt----ggagtctttaagttgggtgtttttgtctct |
341 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38706922 |
gataggagggaattgttgtgg---atttgggttcccttagggtgggctaaggtttggtcggagtctttaagttgggtgtttttgtctct |
38706837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 38707217 - 38707123
Alignment:
| Q |
1 |
taaataaaagagcacaaagttagccaaaccgttactctataaaaggaatttaccctaacagcttagcagctttgccaacaagagaaaagaaacag |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38707217 |
taaataaaagagcacaaagttagccaaaccgttactctataaaaggaatttaccctaacagcttagcagctttgccaacaagagaaaagaaacag |
38707123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University