View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12431_low_10 (Length: 257)
Name: NF12431_low_10
Description: NF12431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12431_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 8 - 193
Target Start/End: Complemental strand, 27935588 - 27935403
Alignment:
| Q |
8 |
aacctgtgtttagattttgttgattagccgttgaaatctttgttggtttactttgcactattttttctttccattagattttctttgaaaaagttattaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27935588 |
aacctgtgtttagattttgttgattagccgttgaaatctttgttggtttactttgcactattttttctttccattagattttctttgaaaaagtttttaa |
27935489 |
T |
 |
| Q |
108 |
tgaggccgagaatgttatatgtgttgccttgagtatttgtctagtctccaaaatttatactattaattcttttcttaataagtttt |
193 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27935488 |
tgaggcagagaatgttatatgtgttgccttgagtatttgtctagtctccaaaatttatactattaattcttttcttaataattttt |
27935403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 257
Target Start/End: Complemental strand, 27935342 - 27935272
Alignment:
| Q |
188 |
agttttcactttattctttcgttccattgctttcaaataaaatagt-ggagcaaaatcaccgaaatcccta |
257 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27935342 |
agttttcactttattatttcattccattgctttcaaataaaatagtgggagcaaaatcaccgaaatcccta |
27935272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University