View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12431_low_11 (Length: 222)

Name: NF12431_low_11
Description: NF12431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12431_low_11
NF12431_low_11
[»] chr4 (1 HSPs)
chr4 (12-203)||(31563750-31563941)


Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 31563941 - 31563750
Alignment:
12 agcagagacggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaa 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31563941 agcagagacggcagtattaccaaaaggtgtgaacgaaggtggctcatggggaagaggattcatcctgcctggaggaggtcttaaaggtggcattccagaa 31563842  T
112 tggatagttcccactctcccaggaggaggattcaattcaaatggcgatccgacagcagcaaaagctcccatcgattgatttccttgcagtga 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
31563841 tggatagttcccactctcccaggaggaggattcaattcaaatggcgatccgacaacagcaaaagctcccatcgattgatttccttgcagtga 31563750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University