View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12432_high_2 (Length: 328)
Name: NF12432_high_2
Description: NF12432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12432_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 66 - 314
Target Start/End: Complemental strand, 6361059 - 6360811
Alignment:
| Q |
66 |
actcacggccaactcacttgcagctagagtaggtaagatatctccatgattatagtattggaaggcagaatatatgtaaccgtatgtttagcaatacaat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6361059 |
actcacggccaactcacttgcagctagagtaggtaagatatctccatgattatagtattggaaggcagaatatatgtaaccttatgtttagcaatacaat |
6360960 |
T |
|
| Q |
166 |
tcgctcaaacctgaaatattgttcctgttatatggtctcagccgcataggtttttgcagcaattttgatccagtggcttactcccttcatttgtttcccc |
265 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360959 |
tcgttcaaacctgaaatattgttcctgttatatggtctcagccgcataggtttttgcagcaattttgatccagtggcttactcccttcatttgtttcccc |
6360860 |
T |
|
| Q |
266 |
tcataatcacgtggacattaacttcctccaacaacagcagcagcaacac |
314 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360859 |
tcataatcacgaggacattaacttcctccaacaacagcagcagcaacac |
6360811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 6 - 65
Target Start/End: Complemental strand, 6361143 - 6361085
Alignment:
| Q |
6 |
atatcatagcacatgtgctgctcgttcaaaatattaatgttagcacacttgcaagcagat |
65 |
Q |
| |
|
||||||||||||| ||| ||| | ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6361143 |
atatcatagcacac-tgcagctagctcacaatattaatgttagcacacttgcaagcagat |
6361085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University