View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12432_high_5 (Length: 274)
Name: NF12432_high_5
Description: NF12432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12432_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 19 - 259
Target Start/End: Original strand, 8134883 - 8135128
Alignment:
| Q |
19 |
tgtttatgtcaatatcatgtgtggtgtttgatatcattgatcgattagaaatagtgtttgattatatgttgcactgaaatttaagattgaaaatgtgttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8134883 |
tgtttatgtcaatatcatgtgtggtgtttgatatcattgattgattagaaatagtgtttgattatatgttgcactgaaatttcagattgaaaatgtgttt |
8134982 |
T |
|
| Q |
119 |
ggtgtccgaggcatgctaatgttggacactaacacatcacccacacatgtacattcaatcgc-----nnnnnnnncttaaattattagaagtgtatatac |
213 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
8134983 |
ggcgtccaaggcatgctaatgttggacactaacacatcacccacacatgtacattcaatcgctttttttttttctcttaaattattagaagtgtatatgc |
8135082 |
T |
|
| Q |
214 |
gtatttatcaatgttgtgtctgatatatgtgtcgacgtgtcctatg |
259 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8135083 |
gtatgtatcaatgttgtgtctgatatacgtgtcgacgtgtcctatg |
8135128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 103 - 169
Target Start/End: Original strand, 8134582 - 8134648
Alignment:
| Q |
103 |
gattgaaaatgtgtttggtgtccgaggcatgctaatgttggacactaacacatcacccacacatgta |
169 |
Q |
| |
|
||||||| || ||| ||||||||||| ||||||| ||||||| ||||||||| || |||| |||||| |
|
|
| T |
8134582 |
gattgaatatatgtctggtgtccgagacatgctagtgttggatactaacacaacatccacgcatgta |
8134648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University