View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12432_low_5 (Length: 296)
Name: NF12432_low_5
Description: NF12432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12432_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 22 - 287
Target Start/End: Complemental strand, 6361395 - 6361131
Alignment:
| Q |
22 |
gcagaggacaaaataacaaaataccaggtctttagattcattaattcaattcacagttgaaacatcaacgattgcatgaatgaactatacacttcattgt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361395 |
gcagaggacaaaataacaaaataccaggtctttagattcattaattcaattcacagttgaaacatcaacgattgcatgaatgaactatacacttcattgt |
6361296 |
T |
 |
| Q |
122 |
ttccatgtgccttcgatgcaacgatttggagttataccaagtaacagcatgtatggagaggttctacttgatatattggataatcctaacaaatattatt |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361295 |
ttccatgtgccttcgatgcaacaatttggagttataccaagtaacaacatgtatgtagaggttctacttgatatattggataatcctaacaaatattatt |
6361196 |
T |
 |
| Q |
222 |
tgtaattaatgtacagatattcacacttaagttagcacctgcacacttcaatgatatcatagcaca |
287 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6361195 |
tgtaattaatgtacagatatttacactt-agttagcacctgcacacttcaatgatatcatagcaca |
6361131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University