View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12434_high_7 (Length: 270)
Name: NF12434_high_7
Description: NF12434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12434_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 55303374 - 55303609
Alignment:
| Q |
17 |
agaagcaaagggatatgaaaagaatgtgattgttgagttattcaaggaaacatatggtaaggtgatcaatagttcactgccttgtagcccagaaaactgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55303374 |
agaagcaaagggatatgaaaagaatgtgattgttgagttattcaaggaaacatatggtaaggtgatcaatagttcactgccttgtagcccagaaaactgt |
55303473 |
T |
 |
| Q |
117 |
caaggtacgcacgcactctaatgctaaagccaatattgttgttttgtatggaccaatcaagtaattaatatgtttaactgtttattatatatctcaacaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55303474 |
caaggtacgcacgcactctaatgctaaagccaatattgttgttttgtatggaccaatcaagtaattaatatgtttaactgtttattatatatctcaacaa |
55303573 |
T |
 |
| Q |
217 |
acaaacnnnnnnngcaataattttgtatgaggcgga |
252 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
55303574 |
acaaacaaaaaaagcaataattttgtatgaggcgga |
55303609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University