View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12434_high_9 (Length: 237)
Name: NF12434_high_9
Description: NF12434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12434_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 27329297 - 27329511
Alignment:
| Q |
1 |
agtagtttgcacaactgcagttgtatagattcattgttttttgacttaattgcggtttttgtcctctgtatttatctttttgcaaaattggtcatcctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27329297 |
agtagtttgcacaactgcagttgtatagatttattgttttttgacttaattgcagtttttgtcctctgtatttatctttttgcaaaattggtcttcctat |
27329396 |
T |
 |
| Q |
101 |
ttcaaaattcgacccattatatcatattctatttacttcagattcatagtttgaattattatggtcaacttctcctaaaatgtgatgagttaatacaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329397 |
ttcaaaattcgacccattatatcatattctatttacttcagattcatagtttgaattattatggtcaacttctcctaaaatgtgatgagttaatacaaag |
27329496 |
T |
 |
| Q |
201 |
aaaatagactagagg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
27329497 |
aaaatagactagagg |
27329511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University