View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12434_low_11 (Length: 229)
Name: NF12434_low_11
Description: NF12434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12434_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 44199244 - 44199467
Alignment:
| Q |
1 |
caatggcttggacaaactctcttcacccttccctctcaccaaaaactcaaagccattcgttccccagatggtgcttcgggctatggcctcgctcgcatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44199244 |
caatggcttggacaaactctcttcacccttccctctcaccaaaaactcaaagccattcgttccccagatggtgtttcgggctatggcctcgctcgcatat |
44199343 |
T |
|
| Q |
101 |
cctccttcttccccaaactcatgtggtccgagggatttaccatcgttggatcccctcttgatcattttcaacaactttggcctcaagattatgccaaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44199344 |
cctccttcttccccaaactcatgtggtctgagggatttaccatcgttggatcccctcttgatcattttcaacaactttggcctcaagattatgccaaaca |
44199443 |
T |
|
| Q |
201 |
ctggtgagcgccattaagagtctt |
224 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
44199444 |
ctggtgagtgccattaagagtctt |
44199467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University