View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12438_high_4 (Length: 316)
Name: NF12438_high_4
Description: NF12438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12438_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 7 - 308
Target Start/End: Original strand, 35917148 - 35917449
Alignment:
| Q |
7 |
gcaattacaagcttgtcatatgcaactttgaattggtaaggctccttagataatccaccgttggtaactgcctcgcagtaaacctgttgacatgaaataa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35917148 |
gcaattacaagcttgtcatatgcaactttgaattggtaaggctctttagataatccaccgttggtaactgcctcgcagtaaacctgttgacatgaaataa |
35917247 |
T |
 |
| Q |
107 |
aattgactaagcatttcactagagagnnnnnnn-ctttgtacaaacataaatttattagtctttcaatttttcacattgaacattccattgtaacagtac |
205 |
Q |
| |
|
| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35917248 |
a-ttgactaagcatttcaatagagagaaaaaaaactttgtacaaacataaatttattagtctttcaatttttcacattgaacattccattgtaacagtac |
35917346 |
T |
 |
| Q |
206 |
agtttttctaaaagaagggtaagtaattgtactcacttcatgtttgtttgtgtcaactccagtgcaggaagctagaaagaagtatgagttgggttccttt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35917347 |
agtttttctaaaagaagggtaagtaattgtactcacttcatgtttgtttgtgtcgactccagtgcaggaagctaaaaagaagtatgagttgggttccttt |
35917446 |
T |
 |
| Q |
306 |
gct |
308 |
Q |
| |
|
||| |
|
|
| T |
35917447 |
gct |
35917449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University