View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12439_high_5 (Length: 257)
Name: NF12439_high_5
Description: NF12439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12439_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 7e-95; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 18485141 - 18485336
Alignment:
| Q |
1 |
tgttcaccccacctgcactcacaagccaaaatttctgctgttacggccattgctacttctgagcagcttgcagttcagtttgctattctggaagatccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
18485141 |
tgttcaccccacctgcactcacaagccaaaatttctgctgttacggccattgctacttctgagcagctcgcagttcagtctgctattctagaagatccgg |
18485240 |
T |
|
| Q |
101 |
tggttcagcaggttaatggtaacgcaagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttc |
196 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18485241 |
tggctcagcaggttaatggtaacgcaagttctgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttc |
18485336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 2 - 200
Target Start/End: Original strand, 11212736 - 11212934
Alignment:
| Q |
2 |
gttcaccccacctgcactcacaagccaaaatttctgctgttacggccattgctacttctgagcagcttgcagttcagtttgctattctggaagatccggt |
101 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||| || |||||| || ||||||| || || ||| |
|
|
| T |
11212736 |
gttcgccccacctgcactcacaagccaaagtttctgctgtttcggccattgctacttctgagtagctcgcgattcagtctgaaattctggcagctctggt |
11212835 |
T |
|
| Q |
102 |
ggttcagcaggttaatggtaacgcaagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcataa |
200 |
Q |
| |
|
|||||||||| ||||||||||||| |||| |||||||| |||||||||||||||||||||||||||| | |||||||||||| ||||||||| ||||| |
|
|
| T |
11212836 |
agttcagcaggctaatggtaacgcaggttctgtcatgtccgaaggcagtagcatgctcgcggttcagtctgattttttggcagctgcggtagtccataa |
11212934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 206 - 250
Target Start/End: Original strand, 18485313 - 18485357
Alignment:
| Q |
206 |
attttttggcagatgcggtagttaaaaatggtaacacaggttctg |
250 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
18485313 |
attttttggcagatgcggtagttcttaatggtaacataggttctg |
18485357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 2 - 200
Target Start/End: Complemental strand, 34216005 - 34215807
Alignment:
| Q |
2 |
gttcaccccacctgcactcacaagccaaaatttctgctgttacggccattgctacttctgagcagcttgcagttcagtttgctattctggaagatccggt |
101 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||| |||| ||||||||||| ||||| | ||||| || ||| |||||| ||||||| |||||||| |
|
|
| T |
34216005 |
gttcgccccgcctgcactcacaagccaaaatttctgttgtttcggccattgcttcttctaaacagctcgcggtttagtttgaaattctggcggatccggt |
34215906 |
T |
|
| Q |
102 |
ggttcagcaggttaatggtaacgcaagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagatgcggtagttcataa |
200 |
Q |
| |
|
|||||| |||||||||||||| || |||| |||||||| |||| ||||||||||||| | |||||| ||||||||||| | | ||||||||||| |
|
|
| T |
34215905 |
agttcagtaggttaatggtaacacaggttctgtcatgtccaaaggtagtagcatgctcgtgattcagtcagattttttggcaactactgtagttcataa |
34215807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 186
Target Start/End: Complemental strand, 34215809 - 34215737
Alignment:
| Q |
114 |
taatggtaacgcaagttccgtcatgtctgaaggcagtagcatgctcgcggttcagtttaattttttggcagat |
186 |
Q |
| |
|
||||||||| ||| ||| ||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34215809 |
taatggtaaggcaggttatgtcatgttcgaaggcagtagcatgctcgcggttcagcctaattttttggcagat |
34215737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University