View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12439_high_6 (Length: 233)
Name: NF12439_high_6
Description: NF12439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12439_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37207578 - 37207798
Alignment:
| Q |
1 |
agtcatcatcgttgcttatgagtgaatgaaatccataggaataggaatgaaatccatagattggtggcttggtgcaccttttttccttcatgtttttgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37207578 |
agtcatcatcgttgcttatgagtgaatgaaatccataggaataggaatgaaatccataggatggtggcttggtgcaccttttttccttcatgtttttgga |
37207677 |
T |
 |
| Q |
101 |
gacttgatttgtggaatttttattcgtgtatagagagtctgaaccaaactcatgggaagacaccatgagagatgaatttgatcgccaaaaatatccacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37207678 |
gacttgatttgtggaatttttattcgtgtatagagagtctgaaccaaactcatgggaagacaccatgagagatgaatttgatcgccaaaaatatccacgt |
37207777 |
T |
 |
| Q |
201 |
atgccatggcatgatgtccat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37207778 |
atgccatggcatgatgtccat |
37207798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Original strand, 37207543 - 37207577
Alignment:
| Q |
18 |
atgagtgaatgaaatccataggaataggaatgaaa |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
37207543 |
atgagtgaatgaaatccataggaataggaatgaaa |
37207577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 138 - 217
Target Start/End: Complemental strand, 13749629 - 13749550
Alignment:
| Q |
138 |
tctgaaccaaactcatgggaagacaccatgagagatgaatttgatcgccaaaaatatccacgtatgccatggcatgatgt |
217 |
Q |
| |
|
||||||||||| ||||||||||| || |||| ||||||||| || || |||||||||| |||||||| ||||||||||| |
|
|
| T |
13749629 |
tctgaaccaaattcatgggaagatacaatgaaagatgaattggaacgtgaaaaatatcctcgtatgccttggcatgatgt |
13749550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University