View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12439_low_6 (Length: 234)
Name: NF12439_low_6
Description: NF12439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12439_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 18485136 - 18484988
Alignment:
| Q |
1 |
tgcacctcagattgtgattcattgagctgggctagcgaggggctcatctccctcgagctttccaataaataacattcattggttggttggagatggatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||| |||||||||||||||||||| ||||||||||||| | |
|
|
| T |
18485136 |
tgcacctcagattgtgattcattgagctgggcaagcgaggggctcatctctctcgagcgttcgaataaataacattcattggtcagttggagatggatca |
18485037 |
T |
|
| Q |
101 |
ccccatgagtgggttctatacgacggattcccaagaatttgttccttca |
149 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
18485036 |
ccccatgagtgggttctatacggcggattcccaagaatttgtgccttca |
18484988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 177 - 218
Target Start/End: Complemental strand, 18484953 - 18484912
Alignment:
| Q |
177 |
taacctgagtgaaaatttcctctgctgtgcgttgatcatatt |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18484953 |
taaccggagtgaaaatttcctctgctgtgcgttgatcatatt |
18484912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 11212730 - 11212678
Alignment:
| Q |
1 |
tgcacctcagattgtgattcattgagctgggctagcgaggggctcatctccct |
53 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| | ||||||| ||||||||||| |
|
|
| T |
11212730 |
tgcacctcagattgagattcattgatctgggttggcgagggactcatctccct |
11212678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University