View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_31 (Length: 295)
Name: NF1243_high_31
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 64 - 295
Target Start/End: Original strand, 22065910 - 22066141
Alignment:
| Q |
64 |
attatgatatttagtttgtttccaagtcaagcttaagctatggtttctttggtttggtgcaaaaacagacattgtgatcaaatgcatatttagaaatggt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22065910 |
attatgatatttagtttgtttccaagtcaagcttaagctatgctttctttggtttggtgcaaaaacagacattgtgatcaaatgcatatttagaaatggt |
22066009 |
T |
 |
| Q |
164 |
tttccatgacataatgaattagcatgagggcctccattaatagaaagctaggatctcaagaatagtgttgagaatgatcttttgacgaagaatcacttct |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22066010 |
tttccatgacataatgaattagcatgagggcctccattaatagaaagctaggatctcaagaatagtgttgagaatgatcttttgacgaagaatcacttct |
22066109 |
T |
 |
| Q |
264 |
tccagaaaaatcaaatttaggcttcatttatt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22066110 |
tccagaaaaatcaaatttaggcttcatttatt |
22066141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University