View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_34 (Length: 293)
Name: NF1243_high_34
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_34 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 14 - 264
Target Start/End: Original strand, 43673948 - 43674198
Alignment:
| Q |
14 |
aggaggacaatcgttctctgcagttgggatgccgaggaatttggcatggtaggcagtatttcctttttaacaacatttttcattaatttgtcttctccaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43673948 |
aggaggacaatcgttctctgcagttgggatgccgaggaatttggcatggtaggcagtatttcctttttaacaacatttttcattaatttgtcttctccaa |
43674047 |
T |
 |
| Q |
114 |
taaggtggttttaagtgtaacccacattttctttgaaaatccaatcactgggtttgnnnnnnnccacatgggtccatcatcatatctaacgccaaatttg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43674048 |
taaggtggttttaagtgtaacccacattttctttgaaaatccaatcactgggtttgtttttttccacatgggtccatcatcatatctaacgccaaatttg |
43674147 |
T |
 |
| Q |
214 |
agcttcagttgcctagaatcacctaggtttgatgcgagtggtggagagtaa |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43674148 |
agcttcagttgcctagaatcacctaggtttgatgcgagtggtggagagtaa |
43674198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 9 - 63
Target Start/End: Complemental strand, 43400626 - 43400572
Alignment:
| Q |
9 |
agcataggaggacaatcgttctctgcagttgggatgccgaggaatttggcatggt |
63 |
Q |
| |
|
|||| ||||||||||| |||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
43400626 |
agcagaggaggacaattgttctccgcagttgggatgtagagaaatttggcatggt |
43400572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University