View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_38 (Length: 284)
Name: NF1243_high_38
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 64 - 284
Target Start/End: Original strand, 410133 - 410353
Alignment:
| Q |
64 |
ttgataatttttgcaggaaaatggctaagaagcaagtatgtgggagtatctatggtttggaaaacattagcaataatgggatttggaaaagttggatctg |
163 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
410133 |
ttgataatttttgcaggaaaatggctgagaagcaagtatgttggagtatctatggttgggaaaacattagcaataatggggtttggaaaagttggatctg |
410232 |
T |
 |
| Q |
164 |
aagttgcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtgctgttggtgtggaattagtctc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
410233 |
aagttgcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtgctgttggtgtggaattagtttc |
410332 |
T |
 |
| Q |
264 |
atttgatcaagcaatcacaac |
284 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
410333 |
atttgatcaagcaatcacaac |
410353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 137 - 231
Target Start/End: Original strand, 48785454 - 48785548
Alignment:
| Q |
137 |
taatgggatttggaaaagttggatctgaagttgcaaggcgtgcaaaaggattaggaatgaatgtgattgctcatgacccttatgctccagctgat |
231 |
Q |
| |
|
||||||||||||| || |||||| |||| ||||| |||||||| || || | || ||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
48785454 |
taatgggatttgggaaggttggaactgaggttgctaggcgtgctaaggggcttggtatgaaggttattgctcatgatccttatgctcctgctgat |
48785548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University