View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_41 (Length: 275)
Name: NF1243_high_41
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 26 - 192
Target Start/End: Original strand, 2441061 - 2441227
Alignment:
| Q |
26 |
ctttcattacccttgctgtgtagtatcattatgatggtggaattgactgccattaacaagcagctcttgtgtgtcccccctcccttaagctcttctggcc |
125 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
2441061 |
ctttcattaaccttgctgtgtagtatcattatgatggtggaattgactgccattaacaagcagttcttgtgtgtcctccctaccttaagctcttctggcc |
2441160 |
T |
|
| Q |
126 |
attccctttacgacccgccacttcctacgcttccgtttgatttggtggcagagatcctgtgtaggct |
192 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2441161 |
attcactttatgacccgccacttcctacgcttccgtttgatttggtggcagagatcctgtgtaggct |
2441227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University