View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_53 (Length: 260)
Name: NF1243_high_53
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 30 - 233
Target Start/End: Original strand, 8553077 - 8553280
Alignment:
| Q |
30 |
ctgtcttgcaaatttgaactatggtttctactagataatcatcaaatttgtagttcctatggttaaagtcaaagctttataagtcaggcataatttgatt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8553077 |
ctgtcttgcaaatttgaactatggtttctactagataatcatcaaatttgtagttcctatggttaaagtcaaagctttataagtcaggcataatttaatt |
8553176 |
T |
 |
| Q |
130 |
ttccgtggtcaggtgcattaatgtgtccaaatacgcaatttcattatgtttatgacttcaaatttcctaagaaactgactatttttattttgcagtatgt |
229 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8553177 |
ttccgtggtcaggtgcattagtgtgtccaaatacgcaatttcattatgtttatgacttcaaatttcctaagaaactgactatttttattttgcagtatgt |
8553276 |
T |
 |
| Q |
230 |
tctg |
233 |
Q |
| |
|
|||| |
|
|
| T |
8553277 |
tctg |
8553280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University