View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1243_high_55 (Length: 256)

Name: NF1243_high_55
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1243_high_55
NF1243_high_55
[»] chr5 (2 HSPs)
chr5 (2-226)||(1956949-1957173)
chr5 (173-205)||(1956569-1956601)


Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 1956949 - 1957173
Alignment:
2 ataacacaacctctcataatcttgaatgacttctaatttcatgaaactgccctgttttgatcagcttcaaacaatgtatgatacaagtacagtgatacat 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1956949 ataacacaacctctcataatcttgaatgacttctaatttcatgaaactgccctgttttgatcagcttcaaacaatgtatgatacaagtacagtgatacat 1957048  T
102 atggcatgaaactccattttggtaagcagtcagtgagttggatttcagacggtacttactaaagtaccttcaggacaattattaaccatcttcaaggaga 201  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
1957049 atggcatgaaactccattttagtaagcagtcagtgagttggatttcagacagtacttactaaagtaccttcaggacaattattaaccatcttcaaggaga 1957148  T
202 tatagaaatttagaaccgtataaat 226  Q
    |||||||||||||||||||||||||    
1957149 tatagaaatttagaaccgtataaat 1957173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 173 - 205
Target Start/End: Original strand, 1956569 - 1956601
Alignment:
173 aggacaattattaaccatcttcaaggagatata 205  Q
    |||| ||||||||||||||||||||||||||||    
1956569 aggagaattattaaccatcttcaaggagatata 1956601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University