View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_59 (Length: 252)
Name: NF1243_high_59
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_59 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 1189484 - 1189679
Alignment:
| Q |
15 |
tatcttaataaagtttctttatcattggatgaggacattgatcgttaatgtatttaaaaataataatacaggggtcacttttattcccatggattgatac |
114 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1189484 |
tatcttaataaagtttctgtatcattggatgatgacattgatcgttaatgtatttaaaaataataatacaggggtcacttttattcccatggattgatac |
1189583 |
T |
 |
| Q |
115 |
gatatttttaatggataatagagtatcaata-nnnnnnnnnaaactcacttaatatctcatactgaaaaagggttattcaggagttatctacaaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1189584 |
gatatttttaatggataatagagtatcaatattttttttttaaactctcttaatatctcatactgaaaaagggttattcaggagttatctacaaaa |
1189679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University