View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_61 (Length: 252)
Name: NF1243_high_61
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 1956938 - 1956695
Alignment:
| Q |
1 |
tattcatgctaacttgagcttagcaaaaagataagacgagnnnnnnngccaacatgtattcttgtttcggaaatttggatgatgcaaaatttgttagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1956938 |
tattcatgctaacttgagcttagcaaaaagataagacgagtttttttgccaacatgtattcttgtttcggaaatttggatgatgcacaatttgttagaga |
1956839 |
T |
 |
| Q |
101 |
tcttatgagtgataaacagttctataaggatctctcgctttactatccattctgtaaaacaaacaataatgatgtattgcttggctataaactcaattat |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1956838 |
tcttacgagtgataaacagttctataaggatccctcgcttcactatccattctgtaaaacaaacaataatgatgtattgcttggctataaactcaactat |
1956739 |
T |
 |
| Q |
201 |
acaaactatacagtgtgagtgtgagctctcaaatcgtctctgct |
244 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1956738 |
acaagctatacagtgtgagtgtgagctctcaaaccgtctctgct |
1956695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 48 - 132
Target Start/End: Complemental strand, 1957412 - 1957328
Alignment:
| Q |
48 |
gccaacatgtattcttgtttcggaaatttggatgatgcaaaatttgttagagatcttatgagtgataaacagttctataaggatc |
132 |
Q |
| |
|
|||||||||||||||| | | |||| | |||||||||| || ||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
1957412 |
gccaacatgtattcttctatgggaagatgggatgatgcacaagttgttagagatcttatgagtgataaccagatacataaggatc |
1957328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University