View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_68 (Length: 251)
Name: NF1243_high_68
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_68 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 6322032 - 6322274
Alignment:
| Q |
1 |
ctccatgggaggatattaatgaaccacatagctacaatcagtttaatgaatatgataaccctatggtcggtattcacatggcaccaaaaacctcttcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6322032 |
ctccatgggaggatattaatgaaccacatagctacaatcagtttaatgaatatgataaccctatggtcggtattcacatggcaccaaaaacctcttcttt |
6322131 |
T |
 |
| Q |
101 |
tgagcccatatatgggttcatgaagactgagcccccttcactccaatattcacagactcaacatcgtagctatatgattccatatcctcaagttgagcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6322132 |
tgagcccatatatgggttcatgaagactgagcccccttcactccaatattcacagactcaacatcgtagctatatgattccatatcctcaagttgagcct |
6322231 |
T |
 |
| Q |
201 |
gttcagtcagttacaacttctctagagaggtgtcatattcttc |
243 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
6322232 |
gttcagtcagttccaacttctctagagaggagtcattttcttc |
6322274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University