View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_high_73 (Length: 248)
Name: NF1243_high_73
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_high_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 22526463 - 22526372
Alignment:
| Q |
1 |
caacaagctcatagctgagtttaagatttaggaatttcagtttttattgctttcctttgaatttttagccattctcttcaactgtaatgctc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22526463 |
caacaagctcatagctgagtttaagatttaggaatttcagtttttattgcttccctttgaatttttagccattctcttcaactgtaatgctc |
22526372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 22525324 - 22525273
Alignment:
| Q |
169 |
agaagttgtcaattacaccagtaccagaacatgtttgtgtcttgaagggctt |
220 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22525324 |
agaagctgtcaattgtaccagtaccagaacatgtttgtgtcttgaagggctt |
22525273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 112 - 163
Target Start/End: Original strand, 22533584 - 22533635
Alignment:
| Q |
112 |
aatgttcgtttgactttttatattaaaatcgtaatataaatgataaatcttt |
163 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
22533584 |
aatgttcgtttgactttttgtattaaaatcgtaatacaaacgataaatcttt |
22533635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 43 - 83
Target Start/End: Complemental strand, 19754314 - 19754273
Alignment:
| Q |
43 |
tttattgctttcctttgaattttt-agccattctcttcaact |
83 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
19754314 |
tttattgctttcctctgaatttttaagccattctcttcaact |
19754273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University