View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1243_high_75 (Length: 213)

Name: NF1243_high_75
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1243_high_75
NF1243_high_75
[»] chr7 (1 HSPs)
chr7 (75-184)||(35155407-35155516)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 35155516 - 35155407
Alignment:
75 gaagaatatcataaaaaatgaagtcatgtatgcttcttctccatataaagtttccatctcactaacaacatatttagattggaaaaatattgaggaatca 174  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35155516 gaagaaaatcataaaaaatgaagtcatgtatgcttcttctccatataaagtttccatctcactaacaacatatttagattggaaaaatattgaggaatca 35155417  T
175 atgaatcaac 184  Q
    ||||||||||    
35155416 atgaatcaac 35155407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University