View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_113 (Length: 252)
Name: NF1243_low_113
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_113 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 48493630 - 48493389
Alignment:
| Q |
11 |
cacagaggaattggcatttttgtccttgtgctaagcattcttcaggtatgccattgactcaatgttataatatataacaataatacttgcaaataacaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493630 |
cacagaggaattggcatttttgtccttgtgctaagcattcttcaggtatgccattgactcaatgttataatatataacaataatacttgcaaataacaaa |
48493531 |
T |
|
| Q |
111 |
gtttagttctcacttatcatactgtcaagtacaattttaactggttaacgcttaaaagctgtgagattaatcacacaagtgtgttatttgcactactaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48493530 |
gtttagttctcacttatcatactgtcaagtacaattttaactggttaacgcttaaaagctgtgagattaatcacacaagtgtgttatttgcaccactaaa |
48493431 |
T |
|
| Q |
211 |
attaaactacttttgcgacaacaatctaaactcattaaccat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48493430 |
attaaactacttttgcgacaacaatctaaactcattaaccat |
48493389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University