View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_115 (Length: 252)
Name: NF1243_low_115
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_115 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 90 - 223
Target Start/End: Complemental strand, 32255630 - 32255497
Alignment:
| Q |
90 |
caggttatcaagtatgtgtatatggtcccatccattgtatgagtctgggtgtgcccttattgttggtcttagtttaggggaaagtttttgaagctcacgg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32255630 |
caggttatcaagtatgtgtatatggtcccatccattgtatgaatctgggtgtgcccttattgttggtcttagtttaggggaaagtttgtgaagctcacgg |
32255531 |
T |
 |
| Q |
190 |
aacagaattttaatgtcaagtgtgaggcgcccaa |
223 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| |
|
|
| T |
32255530 |
aacagaatttttatgtcaagtgtgaggcacccaa |
32255497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 143 - 205
Target Start/End: Complemental strand, 32264640 - 32264578
Alignment:
| Q |
143 |
cccttattgttggtcttagtttaggggaaagtttttgaagctcacggaacagaattttaatgt |
205 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||| || ||||||||||||| ||||||||||| |
|
|
| T |
32264640 |
cccttaatgttggtcttagtttaagggaaaatttgtgtagctcacggaacacaattttaatgt |
32264578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 209
Target Start/End: Complemental strand, 23203314 - 23203249
Alignment:
| Q |
144 |
ccttattgttggtcttagtttaggggaaagtttttgaagctcacggaacagaattttaatgtcaag |
209 |
Q |
| |
|
||||| || |||||| |||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
23203314 |
ccttaatgctggtctatgtttaggggaaagtttgtgaagctcacggaacatgtttttaatgtcaag |
23203249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 136
Target Start/End: Complemental strand, 23203514 - 23203472
Alignment:
| Q |
94 |
ttatcaagtatgtgtatatggtcccatccattgtatgagtctg |
136 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
23203514 |
ttatcaagtatgtgtagctggtcccttccattgtatgagtctg |
23203472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University