View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_116 (Length: 251)
Name: NF1243_low_116
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_116 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 142 - 251
Target Start/End: Complemental strand, 222705 - 222596
Alignment:
| Q |
142 |
ccttctcaatttctcagtatttaattgaaaaatgtcactattacagttacatgactgagaagaatcgaaaactacacaatcagtttaacaccgaagaagc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
222705 |
ccttctcaatttctcagtatttaattgaaaaatgtcactattacagttacatgactgagaagaatcgaaaactacacaatcagtttaacaccgaagaagc |
222606 |
T |
|
| Q |
242 |
ttccacttct |
251 |
Q |
| |
|
|||||||||| |
|
|
| T |
222605 |
ttccacttct |
222596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 9 - 110
Target Start/End: Complemental strand, 222833 - 222732
Alignment:
| Q |
9 |
agcagagaacaactaccaccaccaaccagaaaaccttaggcgttgcctgagggaagaactcttctaattccacgaaatcccctttctcggatgttgccag |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
222833 |
agcagaaaacaactaccaccaccaaccagaaaaccttaggcgtcgcctgggggaagaactcttctaattccacaaaatcccctttctccgatgttgccag |
222734 |
T |
|
| Q |
109 |
gt |
110 |
Q |
| |
|
|| |
|
|
| T |
222733 |
gt |
222732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University