View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_123 (Length: 250)
Name: NF1243_low_123
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_123 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 4961180 - 4961423
Alignment:
| Q |
1 |
cctaacattccccgttaaccaatccaataannnnnnnacttttcaacaatatactataattaaaagtaagtattaagcagattataactaatctactgac |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961180 |
cctaacattccccgttaaccaataaaataatttttttgcttttcaacaatatactataattaaaagtaagtattaagcagattataactaatctactgac |
4961279 |
T |
 |
| Q |
101 |
attgtcattatggttgaattggtcaagattttgaactatagaagtgaggctcgtgctctttaatgattaatctaatgggataacaaggacagactctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961280 |
attgtcattatggttgaattggtcaagattttgaactatagaagtgaggctcgtgctctttaatgattaatctaatgggataacaaggacagactctttg |
4961379 |
T |
 |
| Q |
201 |
ttaaaagttgtagccatgaaattcaagtgggtcacctatgctac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4961380 |
ttaaaagttgtagccatgaaattcaagtgggtcacctatgctac |
4961423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University