View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_130 (Length: 228)
Name: NF1243_low_130
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_130 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 135 - 215
Target Start/End: Complemental strand, 43506832 - 43506752
Alignment:
| Q |
135 |
tctctccactcccagcttcgctccaagggacattctcttagaacctctcgctgcaatttgttaaacttcttattgcaacag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| |
|
|
| T |
43506832 |
tctctccactcccagcttcgctccaagggacattctcttagaacctcttgctgtaatttgttaaacttcttattgtaacag |
43506752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 23 - 140
Target Start/End: Complemental strand, 19963746 - 19963630
Alignment:
| Q |
23 |
tagcattcatcaaagtgaatgacttgtagtaatnnnnnnnntgaatgacttgtagatgatactaaattgggtactgccaaagcattgcatttccatttct |
122 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | ||||||||| || |||||||||||||||| ||||||||||||| |||| | |||||| |
|
|
| T |
19963746 |
tagcattcatcgaagtgaatgacttgtagtactaacaaaagtgaatgacta-taaatgatactaaattgggcactgccaaagcatcacattcctatttct |
19963648 |
T |
|
| Q |
123 |
ccagttttgaaatctctc |
140 |
Q |
| |
|
|| |||||||||| |||| |
|
|
| T |
19963647 |
cctgttttgaaatatctc |
19963630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 64 - 140
Target Start/End: Original strand, 19910343 - 19910419
Alignment:
| Q |
64 |
tgaatgacttgtagatgatactaaattgggtactgccaaagcattgcatttccatttctccagttttgaaatctctc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19910343 |
tgaatgacttgtagatgatactaaattggacactgccaaaacattgcatttccatttctcccgttttgaaatctctc |
19910419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 12 - 51
Target Start/End: Original strand, 19910317 - 19910356
Alignment:
| Q |
12 |
aatgcaaaaaatagcattcatcaaagtgaatgacttgtag |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19910317 |
aatgcaaaaaatagcattcatcaaagtgaatgacttgtag |
19910356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University