View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_132 (Length: 217)
Name: NF1243_low_132
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_132 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 111 - 193
Target Start/End: Original strand, 39793435 - 39793517
Alignment:
| Q |
111 |
ccctgcaacaggtttgtttctacttcccnnnnnnnggggactgagcacaacaaaagataccatcatacgaagtggtaggttgc |
193 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39793435 |
ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgc |
39793517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University