View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_134 (Length: 213)
Name: NF1243_low_134
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_134 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 75 - 184
Target Start/End: Complemental strand, 35155516 - 35155407
Alignment:
| Q |
75 |
gaagaatatcataaaaaatgaagtcatgtatgcttcttctccatataaagtttccatctcactaacaacatatttagattggaaaaatattgaggaatca |
174 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35155516 |
gaagaaaatcataaaaaatgaagtcatgtatgcttcttctccatataaagtttccatctcactaacaacatatttagattggaaaaatattgaggaatca |
35155417 |
T |
 |
| Q |
175 |
atgaatcaac |
184 |
Q |
| |
|
|||||||||| |
|
|
| T |
35155416 |
atgaatcaac |
35155407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University