View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1243_low_139 (Length: 204)

Name: NF1243_low_139
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1243_low_139
NF1243_low_139
[»] chr3 (1 HSPs)
chr3 (80-161)||(8528190-8528271)


Alignment Details
Target: chr3 (Bit Score: 62; Significance: 5e-27; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 80 - 161
Target Start/End: Original strand, 8528190 - 8528271
Alignment:
80 attatcaacacgtttgctgttgtcaatttatgcagtgtgcgcattcatagatgcactgtaatttcctatgaatcttcatctc 161  Q
    |||||||||| |||| ||| |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
8528190 attatcaacatgttttctggtgtcgatttatgcagtgtgcggattcatagatgcactgtaatttcctatgaatcttcatctc 8528271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University