View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_20 (Length: 449)
Name: NF1243_low_20
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 57 - 420
Target Start/End: Complemental strand, 45383649 - 45383287
Alignment:
| Q |
57 |
gttccggaccgaaaccaagctcaatccttaatgaagtctactacagaggcgcatggtaggacaccgtactgctagcatgtctgagtgtatccgtccaaca |
156 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45383649 |
gttccggaccgaacccaagctcaatccttaatgaagtctactacagaggcgcatggtaggacaccatactgctagcatgtctgagtgtatccgtccaaca |
45383550 |
T |
|
| Q |
157 |
atcaatcagcacacacataatcaacataagatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaaattttgctcaattctcttgaaa |
256 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45383549 |
atcaatcagcacgcacataatcaacataagatgttgttccgcgaaccatgcagagaatctctcaacggcctcaacgaatttttgctcaattctcttgaaa |
45383450 |
T |
|
| Q |
257 |
ctctacctataaaaggacacctcagctaggataaacatacacattccattatgttaaacgtctcatgcaccgcactcaaaaactgacttgagcgtttagt |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45383449 |
ctctacctataaaaggacacctcagctaggataaacatacacattccattatgttaaacgtctcatgcaccgcactcaaaaactgacttgagcg-ttagt |
45383351 |
T |
|
| Q |
357 |
gtttgcatatacaacacccctgccaaagagctcagccatcgtcctcagttgcgtttcatcaacc |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45383350 |
gtttgcatatacaacacccctgccaaagagctcagccatcgtcctcagttgcgtttcatcaacc |
45383287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University