View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_31 (Length: 401)
Name: NF1243_low_31
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 4e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 81 - 307
Target Start/End: Complemental strand, 42983591 - 42983365
Alignment:
| Q |
81 |
caaaggagagagagggaaaacagaaccttaaaaaccgcctaacttggagtatagaatatatatttcctctcaaaaaatcnnnnnnnnnnnnngtgttatg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
42983591 |
caaaggagagagagggaaaacagaaccttaaaaaccgcctaacttggagtatagaatatctatttcctctcaaaaaatctttttttctttttgtgttatg |
42983492 |
T |
|
| Q |
181 |
tgagtttcctcactttactttgaatttccatttccatggagtcttttccaccttcttcaaatcctctcttccatctctatcatcctcacaacaaatcaaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983491 |
tgagtttcctcactttactttgaatttccatttccatggagtcttctccaccttcttcaaatcctctcttccatctctatcatcctcacaacaaatcaaa |
42983392 |
T |
|
| Q |
281 |
aatgcaccatcccattttcctctttgc |
307 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42983391 |
aatgcaccatcccattttcctctttgc |
42983365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University