View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_36 (Length: 387)
Name: NF1243_low_36
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 15 - 358
Target Start/End: Complemental strand, 41575409 - 41575066
Alignment:
| Q |
15 |
cttagcccaaaatacaaacatatactaaccaattcatccaacaaaaacatgaaattcaacagaacccacttttggctttctggttttgccatccttctct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41575409 |
cttagcccaaaatacaaacatatactaaccaattcatccaacaaaaacatgaaattcaacagaaccctcttttggctttctggttttgccatccttctct |
41575310 |
T |
|
| Q |
115 |
tttctatcatcattgttcattacaccacaccaccttcaaacacctctaacactgccaccagtagttctctaggtagtttattaagcaagataataaaggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
41575309 |
tttctatcatcattgttcattacaccacaccaccttcaaacacctctaacactgccaccagtagttctctagatagtttattaagcaagataataaagct |
41575210 |
T |
|
| Q |
215 |
aagtggtgctcaaggttttgtgtctttgttgataacaagtattgcgagtacgagacatcatcattggatgaggcataaggaaaaatgcgacgaggtcaaa |
314 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
41575209 |
acgtggtgctcaagattttgtgtctttgttgataacaagtattgcgagtacgagacatcatcattggatgaggcataaggaaaaatgtgacgaggccaaa |
41575110 |
T |
|
| Q |
315 |
cgggcttcacaactaattttagactataatgcgaccatcacttt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41575109 |
cgggcttcacaactaattttagactataatgcgaccatcacttt |
41575066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University