View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_43 (Length: 377)
Name: NF1243_low_43
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 255 - 353
Target Start/End: Complemental strand, 14138136 - 14138038
Alignment:
| Q |
255 |
tgtcttagaaaataacaagaaaacttgaaggttaagcaatgatgtttgttgaacagttttatgttttattttaattttaaattaaatccaacggctaat |
353 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
14138136 |
tgtcttagaaaataacaagaaaatttgaaggtttagcaatgatgtttgttgaacagttttatgttttattttaattttaaatttaatccaacggctaat |
14138038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University