View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_48 (Length: 357)
Name: NF1243_low_48
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 92 - 287
Target Start/End: Original strand, 222455 - 222650
Alignment:
| Q |
92 |
gatatgtgttacacgatgccttgagaaataattctcaaatcttccaccatactttaacatgtatccacgcagttcctgactggaaggaacggtgaaacca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
222455 |
gatatgtgttacacgatgccttgagaaataattctcaaatcttccaccatactttaacatgtatccacgcagttcctgactggatggaacggtgaaacca |
222554 |
T |
 |
| Q |
192 |
tcgacaaaaattgaaactccggcgaatatagggttcacacaagaagtggaagcttcttcggtgttaaactgattgtgtagttttcgattcatctca |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
222555 |
tcgacaaaaattgaaactccggcgaatatagggttcccacaagaagtggaagcttcttcggtgttaaactgattgtgtagttttcgattcttctca |
222650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University