View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_52 (Length: 345)
Name: NF1243_low_52
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 60 - 246
Target Start/End: Original strand, 45367699 - 45367886
Alignment:
| Q |
60 |
agaaagagaagcagagttattaagggagggg-ggtcctactggtgtttatatttttgttggcaacaacagtctctatcaatgatttgggtggtggtgtgt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367699 |
agaaagagaagcagagttattaagggagggggggtcctactggtgtttatatttttgttggcaacaacagtctctatcaatgatttgggtggtggtgtgt |
45367798 |
T |
|
| Q |
159 |
ggttactctctatgatcaattgacccacccaatcaatatcaatatcactcttctttctaccttaacatttttatctaattaaccaata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367799 |
ggttactctctatgatcaattgacccacccaatcaatatcaatatcactcttctttctaccttaacatttttatctaattaaccaata |
45367886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 290 - 334
Target Start/End: Original strand, 45367930 - 45367974
Alignment:
| Q |
290 |
attgctaggaacacaattcaaaaggtgaaaacggatctcattcat |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45367930 |
attgctaggaacacaattcaaaaggtgaaaacggatctcattcat |
45367974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University