View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_53 (Length: 345)
Name: NF1243_low_53
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_53 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 36 - 316
Target Start/End: Complemental strand, 52851124 - 52850845
Alignment:
| Q |
36 |
aaccgacctgagtttgaattgctgaaatgtcccctttttcccccctcaagctagctctattaaagggtagacattgtgtccttccaactaagggatttta |
135 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851124 |
aaccgacctgaatttaaattgctgaaatgtcccctttttccccc-tcaagctagctctattaaagggtagacattgtgtccttccaactaagggatttta |
52851026 |
T |
|
| Q |
136 |
tgctcttacgtcggcttaagaagccaaatccaaaagttttctttgaggtctcggccgtgttaataaaaccaaccaactttgcaacaagcgcagcactttc |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52851025 |
tgctcttacgtcggcttaagaagccaaatccaaaagttttctttgaggtctcacccgtgttaataaaaccaaccaactttgcaacaagcgcagcactttc |
52850926 |
T |
|
| Q |
236 |
tcttatgtggttcaaatctcttgtatccgtccatatgagccatgccaattgtatacttctgtgttttgtcttcaaatcaat |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52850925 |
tcttatgtggttcaaatctcttgtatccgtccatatgagccatgccaattgtatacttctgtgttttgtcttcaaatcaat |
52850845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University