View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_57 (Length: 328)
Name: NF1243_low_57
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_57 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 100 - 249
Target Start/End: Complemental strand, 39254319 - 39254170
Alignment:
| Q |
100 |
cattgaagagaggttggaaggttttgaatggctcttgtgggaaaaccgatgggaaagtcaaaatgggtgggtgtgagaattgataagttttagcactgaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39254319 |
cattgaagagaggttggaaggttttgaatggctcttgtgggaaaaccgatgggaaagtcaaaatgggtgggtgtgagaattgataagttttagcactgaa |
39254220 |
T |
 |
| Q |
200 |
aaatgggtcctacatttgtttgcaaatttgttcttttgcttgctttgcct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39254219 |
aaatgggtcctacatttgtttgcaaatttgttcttttgcttgctttgcct |
39254170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University