View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1243_low_57 (Length: 328)

Name: NF1243_low_57
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1243_low_57
NF1243_low_57
[»] chr4 (1 HSPs)
chr4 (100-249)||(39254170-39254319)


Alignment Details
Target: chr4 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 100 - 249
Target Start/End: Complemental strand, 39254319 - 39254170
Alignment:
100 cattgaagagaggttggaaggttttgaatggctcttgtgggaaaaccgatgggaaagtcaaaatgggtgggtgtgagaattgataagttttagcactgaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39254319 cattgaagagaggttggaaggttttgaatggctcttgtgggaaaaccgatgggaaagtcaaaatgggtgggtgtgagaattgataagttttagcactgaa 39254220  T
200 aaatgggtcctacatttgtttgcaaatttgttcttttgcttgctttgcct 249  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
39254219 aaatgggtcctacatttgtttgcaaatttgttcttttgcttgctttgcct 39254170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University