View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1243_low_61 (Length: 321)
Name: NF1243_low_61
Description: NF1243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1243_low_61 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 94 - 218
Target Start/End: Original strand, 10551493 - 10551617
Alignment:
| Q |
94 |
ttgacattatacattatatccaatataaaattaaccaatcccaaacccttgaattaagcagtgggaattttgtgtatcctttgttaagattgtgatttta |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10551493 |
ttgacattatacattatatccaatataaaattaaccaatcccaaacccttgtattaagcagtgggaattttgtgtatcctttgttaagattatgatttta |
10551592 |
T |
|
| Q |
194 |
agctttggagcttagtattccttat |
218 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
10551593 |
agctttggagcttagtattccttat |
10551617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 296
Target Start/End: Original strand, 10551711 - 10551769
Alignment:
| Q |
238 |
tattactaataaataagagggnnnnnnntacatcataaccgttacacacaaatacaatt |
296 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||| ||||||| |
|
|
| T |
10551711 |
tattactaataaataagagggaaaaaaatatatcataaccgttacacacaattacaatt |
10551769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University